Gene Information

Name : ECs1408 (ECs1408)
Accession : NP_309435.1
Strain : Escherichia coli Sakai
Genome accession: NC_002695
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1455431 - 1455628 bp
Length : 198 bp
Strand : +
Note : similar to hypothetical protein L0009 [Escherichia coli] gi|3414877|gb|AAC31488.1

DNA sequence :
ATGAAATCATTAACCACGGAAACAGCGCTGGATATTCTGATTGCGTGGCTGCAGGACAATATCGACTGCGGATCGGGAAT
TATCTTTGACAACGATGAGGATAAAACGGATTCAGCAGCACTGTTGCCCTGTATCGAACAGGCCCGGGAGGATGTCCGTA
CCCTGCGTCATCTGCAGCTTCTGCACCAGAACCGGTGA

Protein sequence :
MKSLTTETALDILIAWLQDNIDCGSGIIFDNDEDKTDSAALLPCIEQAREDVRTLRHLQLLHQNR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed AAL08480.1 unknown Not tested SRL Protein 4e-24 100
Z1225 NP_286759.1 hypothetical protein Not tested TAI Protein 5e-24 100
Z1663 NP_287165.1 hypothetical protein Not tested TAI Protein 3e-24 100
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE Protein 2e-23 99
unnamed CAE85206.1 hypothetical protein Not tested PAI V 536 Protein 2e-23 97
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 Protein 5e-23 96
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 Protein 7e-23 96
unnamed CAD42103.1 hypothetical protein Not tested PAI II 536 Protein 6e-23 96
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE Protein 1e-21 93
unnamed ADD91697.1 hypothetical conserved protein Not tested PAI-I AL862 Protein 2e-22 93
unnamed CAI43850.1 hypothetical protein Not tested LEE Protein 2e-22 93
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 Protein 1e-21 91
unnamed AAK00484.1 unknown Not tested SHI-1 Protein 1e-21 91
z1225 CAD33791.1 Z1225 protein Not tested PAI I 536 Protein 3e-22 91
unnamed CAD66209.1 hypothetical protein Not tested PAI III 536 Protein 1e-21 90
Z5093 NP_290244.1 hypothetical protein Not tested LEE Protein 5e-16 89
unnamed AAC31488.1 L0009 Not tested LEE Protein 4e-16 89
ECs4541 NP_312568.1 hypothetical protein Not tested LEE Protein 5e-16 89
unnamed ACU09435.1 conserved hypothetical protein Not tested LEE Protein 4e-16 89

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
ECs1408 NP_309435.1 hypothetical protein VFG1071 Protein 2e-24 100
ECs1408 NP_309435.1 hypothetical protein VFG1622 Protein 3e-23 96
ECs1408 NP_309435.1 hypothetical protein VFG0665 Protein 4e-22 91
ECs1408 NP_309435.1 hypothetical protein VFG1532 Protein 1e-22 91
ECs1408 NP_309435.1 hypothetical protein VFG1684 Protein 5e-22 90
ECs1408 NP_309435.1 hypothetical protein VFG0788 Protein 2e-16 89