Gene Information

Name : SAS0030 (SAS0030)
Accession : YP_042163.1
Strain : Staphylococcus aureus MSSA476
Genome accession: NC_002953
Putative virulence/resistance : Unknown
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 41620 - 41931 bp
Length : 312 bp
Strand : -
Note : Ortholog of S. aureus MRSA252 (BX571856) SAR0057; Similar to Staphylococcus hominis hypothetical protein Orf11 SWALL:Q8VUW8 (EMBL:AB063171) (103 aa) fasta scores: E(): 1.7e-36, 93.2% id in 103 aa

DNA sequence :
ATGAAAATCAATCGATACATCACAAAAGGCATTAGTAAACAACTATCTCTAGACCTTCAAATCCTACTTTGGAATATGGT
AAAAGATCGAGACAATCAACTTAATACAGATTACCTACACATTTTTAAACTACAAGAAGATGAAAATATACTCTCAATCA
CACATGAACAAGAACAACCCGCATACAAATTGGAATATCACTATACAAACTATATAAAAAATCAAAATGCATTACCTAAG
AAAGTCTACGTCATCCGAGAAGATGATGTAGACGTTTTTTATTATGTGATGCTTTTACCAGAAGAATACTAA

Protein sequence :
MKINRYITKGISKQLSLDLQILLWNMVKDRDNQLNTDYLHIFKLQEDENILSITHEQEQPAYKLEYHYTNYIKNQNALPK
KVYVIREDDVDVFYYVMLLPEEY

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAS0030 YP_042163.1 hypothetical protein Not tested SCC476 Protein 2e-42 100
unnamed BAB83490.1 - Not tested SCC 12263 Protein 9e-41 94
unnamed BAG06214.1 hypothetical protein Not tested Type-VII SCCmec Protein 1e-41 93
unnamed BAA94662.1 - Not tested Type-II SCCmec Protein 2e-39 92
SERP2503 YP_190045.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-39 92
SAR0057 YP_039528.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-39 92
SAV0059 NP_370583.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-39 92
SA0055 NP_373295.1 hypothetical protein Not tested Type-II SCCmec Protein 3e-39 92
SE0053 NP_763608.1 hypothetical protein Not tested SCCpbp4 Protein 6e-40 91
SACOL0038 YP_184949.1 hypothetical protein Not tested Type-I SCCmec Protein 2e-39 90
unnamed BAB46980.2 hypothetical protein Not tested Type-IIIinv SCCmec Protein 2e-38 90
unnamed BAA94330.1 hypothetical protein Not tested Type-I SCCmec Protein 6e-40 90
SH0058 YP_251973.1 hypothetical protein Not tested SCCmec Protein 9e-39 88
SE0031 NP_763586.1 hypothetical protein Not tested SCCpbp4 Protein 4e-39 88
unnamed ACL99846.1 hypothetical protein Not tested Type-V SCCmec Protein 1e-38 88
SAMSHR1132_00370 YP_005324561.1 hypothetical protein Not tested Type-IIIinv SCCmec Protein 1e-37 86
MW0036 NP_644851.1 hypothetical protein Not tested Type-IV SCCmec Protein 1e-37 86
unnamed BAB72111.1 hypothetical protein Not tested Type-IVa SCCmec Protein 7e-38 86
unnamed BAB72130.1 hypothetical protein Not tested Type-IVb SCCmec Protein 7e-38 86
SAPIG0052 YP_005732862.1 hypothetical protein Not tested Type-V SCCmec Protein 6e-39 86
unnamed BAC67563.1 hypothetical protein Not tested Type-IVc SCCmec Protein 7e-38 86
unnamed BAD24837.1 hypothetical protein Not tested Type-V SCCmec Protein 4e-38 86
unnamed BAB47670.1 hypothetical protein Not tested Type-III SCCmec Protein 3e-16 50
unnamed BAC53832.1 hypothetical protein Not tested SRImec-III and SCCmec-III region Protein 3e-16 50
unnamed ACL99834.1 hypothetical protein Not tested Type-V SCCmec Protein 3e-16 50
SAPIG0036 YP_005732846.1 hypothetical protein Not tested Type-V SCCmec Protein 4e-16 50
unnamed BAG06193.1 hypothetical protein Not tested Type-VII SCCmec Protein 3e-16 50
SSP0048 YP_300138.1 hypothetical protein Not tested SCC15305cap Protein 2e-17 50
SARLGA251_00340 YP_005754049.1 hypothetical protein Not tested Type-XI SCCmec Protein 2e-15 48
unnamed BAB47601.1 hypothetical protein Not tested Type-III SCCmec Protein 2e-15 48
SSP0032 YP_300122.1 hypothetical protein Not tested SCC15305RM Protein 2e-14 45
unnamed AAL26664.1 unknown Not tested SCCcap1 Protein 1e-10 43