
|
Name : STY4034 Accession : - Strain : Salmonella enterica CT18 Genome accession: NC_003198 Putative virulence/resistance : Unknown Product : putative IS1351 transposase (pseudogene) Function : - COG functional category : - COG ID : - EC number : - Position : 3895555 - 3895689 bp Length : 135 bp Strand : - Note : This CDS appears to be a gene remnant which is similar to several transposases including: Salmonella enteritidis IS1351 transposase OrfA TR:O06945 (EMBL:Z83734) (88 aa) fasta scores: E(): 1.3e-09, 68.2% id in 44 aa, Yersinia enterocolitica IS1400 transpos DNA sequence : ATGCGTAAAGCCCGTCTCACTGAGCATCAGAACATCGCCGTAATTAAGTTGGTCGAAGCTGGACGAGCGGTTAAAGATAT CTGCCAGGAGGCGGATATTTCTGAAGTGACTGACGACATCTATGGACATTGGGTT Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| STY4034 | - | putative IS1351 transposase (pseudogene) | Not tested | SPI-3 | DNA | 1e-70 | 100 |
| tnpA | YP_218663.1 | transposase | Not tested | SPI-3 | DNA | 2e-65 | 95.6 |