Gene Information

Name : ECAt040 (ECAt040)
Accession : -
Strain : Pectobacterium atrosepticum SCRI1043
Genome accession: NC_004547
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2846049 - 2846138 bp
Length : 90 bp
Strand : +
Note : tRNA Ser anticodon GGA, Cove score 62.30

DNA sequence :
GGTGAGGTGTCCGAGAGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGTGAAAACGTATCAAGGGTTCGAATCCCTTC
CTCACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 1e-19 94.2
serX - tRNA-Ser Not tested TAI DNA 1e-19 94.2
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 3e-18 91.9
unnamed - tRNA-Ser Not tested VPI-2 DNA 3e-18 91.9
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 3e-18 91.9