
|
Name : ACIADtRNASer_73 (ACIADtRNASer_73) Accession : - Strain : Acinetobacter sp. ADP1 Genome accession: NC_005966 Putative virulence/resistance : Unknown Product : tRNA-Ser Function : - COG functional category : - COG ID : - EC number : - Position : 3327459 - 3327548 bp Length : 90 bp Strand : + Note : Evidence 2a : Function of homologous gene experimentally demonstrated in an other organism; Product type n : RNA DNA sequence : GGTGAGGTGTCCGAGTGGCTTAAGGAGCACGCCTGGAAAGTGTGTATACGTTTTCGCGTATCGAGGGTTCGAATCCCTCT CTCACCGCCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| serW | - | tRNA-Ser | Not tested | TAI | DNA | 1e-19 | 95.2 |
| serX | - | tRNA-Ser | Not tested | TAI | DNA | 1e-19 | 95.2 |
| VC0395_A1356 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 94 |
| unnamed | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 94 |
| tRNA-Ser-2 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 94 |