Gene Information

Name : pNG6055 (pNG6055)
Accession : YP_134313.1
Strain :
Genome accession: NC_006394
Putative virulence/resistance : Resistance
Product : putative cation binding protein
Function : -
COG functional category : P : Inorganic ion transport and metabolism
COG ID : COG2608
EC number : -
Position : 41752 - 41961 bp
Length : 210 bp
Strand : +
Note : -

DNA sequence :
ATGTACCTCTGTATGACGACGACCATCACCGTGGAAGGAATGTCGTGCGGTCACTGTGAGCAGACGGTCGAAGAGGCCCT
CGAAGAGGTATCCGGCGTGACTGACGTGACCGTCGACAGGGAGAGCGAACAGGCGAGCGTCGATGGTGAGGCAAATGTCA
CAGCTCTCGTGGAGGCCGTCGAAGACGCCGGGTACACCGCTTACGCCTGA

Protein sequence :
MYLCMTTTITVEGMSCGHCEQTVEEALEEVSGVTDVTVDRESEQASVDGEANVTALVEAVEDAGYTAYA

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
merP AET25399.1 MerP Not tested PAGI-2(C) Protein 1e-05 44
merP AFG30122.1 MerP Not tested PAGI-2 Protein 1e-05 44
merP AGK07023.1 MerP Not tested SGI1 Protein 1e-05 44
merP AGK07081.1 MerP Not tested SGI1 Protein 1e-05 44
merP CAJ77062.1 Periplasmic mercuric ion binding protein Not tested AbaR1 Protein 4e-06 44
merP YP_006098389.1 mercuric ion transport protein Not tested Tn2411 Protein 2e-05 44
merP ACN81007.1 MerP periplasmic mercuric ion binding protein Not tested AbaR5 Protein 6e-06 44
merP ABQ57373.1 MerP Not tested SGI1 Protein 1e-05 44

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
pNG6055 YP_134313.1 putative cation binding protein BAC0231 Protein 3e-06 42
pNG6055 YP_134313.1 putative cation binding protein BAC0678 Protein 6e-06 42
pNG6055 YP_134313.1 putative cation binding protein BAC0674 Protein 1e-06 42