
|
Name : pNG6055 (pNG6055) Accession : YP_134313.1 Strain : Genome accession: NC_006394 Putative virulence/resistance : Resistance Product : putative cation binding protein Function : - COG functional category : P : Inorganic ion transport and metabolism COG ID : COG2608 EC number : - Position : 41752 - 41961 bp Length : 210 bp Strand : + Note : - DNA sequence : ATGTACCTCTGTATGACGACGACCATCACCGTGGAAGGAATGTCGTGCGGTCACTGTGAGCAGACGGTCGAAGAGGCCCT CGAAGAGGTATCCGGCGTGACTGACGTGACCGTCGACAGGGAGAGCGAACAGGCGAGCGTCGATGGTGAGGCAAATGTCA CAGCTCTCGTGGAGGCCGTCGAAGACGCCGGGTACACCGCTTACGCCTGA Protein sequence : MYLCMTTTITVEGMSCGHCEQTVEEALEEVSGVTDVTVDRESEQASVDGEANVTALVEAVEDAGYTAYA |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| merP | ACN81007.1 | MerP periplasmic mercuric ion binding protein | Not tested | AbaR5 | Protein | 6e-06 | 44 |
| merP | ABQ57373.1 | MerP | Not tested | SGI1 | Protein | 1e-05 | 44 |
| merP | AET25399.1 | MerP | Not tested | PAGI-2(C) | Protein | 1e-05 | 44 |
| merP | AFG30122.1 | MerP | Not tested | PAGI-2 | Protein | 1e-05 | 44 |
| merP | AGK07023.1 | MerP | Not tested | SGI1 | Protein | 1e-05 | 44 |
| merP | AGK07081.1 | MerP | Not tested | SGI1 | Protein | 1e-05 | 44 |
| merP | CAJ77062.1 | Periplasmic mercuric ion binding protein | Not tested | AbaR1 | Protein | 4e-06 | 44 |
| merP | YP_006098389.1 | mercuric ion transport protein | Not tested | Tn2411 | Protein | 2e-05 | 44 |
| Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
| pNG6055 | YP_134313.1 | putative cation binding protein | BAC0231 | Protein | 3e-06 | 42 |
| pNG6055 | YP_134313.1 | putative cation binding protein | BAC0678 | Protein | 6e-06 | 42 |
| pNG6055 | YP_134313.1 | putative cation binding protein | BAC0674 | Protein | 1e-06 | 42 |