Gene Information

Name : SSPt46 (SSPt46)
Accession : -
Strain : Staphylococcus saprophyticus ATCC 15305
Genome accession: NC_007350
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1004327 - 1004418 bp
Length : 92 bp
Strand : +
Note : SSPtRNA46

DNA sequence :
GGAGAGTTGTCCGAGTTGGCCGAAGGAGCACGCCTGGAAAGTGTGTAGGCGCCACAAGCGTCTCGAGGGTTCGAATCCCT
CACTCTCCGCTA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SAMSHR1132_t09 - tRNA-Ser Not tested vSa¥â DNA 3e-44 100
SAtRNA19 - tRNA-Ser Not tested vSa¥â DNA 3e-44 100
SAVtRNA17 - tRNA-Ser Not tested vSa¥â DNA 3e-44 100
SEt07 - tRNA-Ser Not tested vSe2 DNA 2e-43 98.9
NWMN_tRNA16 - tRNA-Ser Not tested vSa¥â DNA 2e-33 96
SACOL_tRNA-Ser-3 - tRNA-Ser Not tested vSa¥â DNA 2e-33 96
MWtRNA17 - tRNA-Ser Not tested vSa¥â DNA 2e-33 96