
|
Name : Pfl01_R8 (Pfl01_R8) Accession : - Strain : Pseudomonas fluorescens Pf0-1 Genome accession: NC_007492 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 353031 - 353106 bp Length : 76 bp Strand : - Note : - DNA sequence : GCCGGTATAGCTCAGATGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGGGTTCGATTCCTGGTGCCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| BJAB07104_tRNA9 | - | tRNA-Thr | Not tested | AbaR25 | DNA | 6e-25 | 89 |
| BJAB0868_tRNA9 | - | tRNA-Thr | Not tested | AbaR26 | DNA | 6e-25 | 89 |