Gene Information

Name : SBO_4153 (SBO_4153)
Accession : YP_410408.1
Strain : Shigella boydii Sb227
Genome accession: NC_007613
Putative virulence/resistance : Unknown
Product : IS629 ORF1
Function : -
COG functional category : L : Replication, recombination and repair
COG ID : COG2963
EC number : -
Position : 4203113 - 4203388 bp
Length : 276 bp
Strand : +
Note : Code: L; COG: COG2963

DNA sequence :
ATGGTTCTGGAAAGTCAGGGCGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACACC
GGAGACTCTGCGTGTCTGGGTACGCCAGCATGAGCGGGATACCGGAGGCGGTGATGGCGGGCTCACCACCGCTGAACGTC
AGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTT
GCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAGTGA

Protein sequence :
MVLESQGEYDSQWAAICSIAPKIGCTPETLRVWVRQHERDTGGGDGGLTTAERQRLKELERENRELRRSNDILRQASAYF
AKAEFDRLWKK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
Z1199 NP_286734.1 hypothetical protein Not tested TAI Protein 2e-22 99
Z1222 NP_286757.1 hypothetical protein Not tested TAI Protein 2e-22 99
Z1639 NP_287142.1 hypothetical protein Not tested TAI Protein 2e-22 99
unnamed AAF09023.1 unknown Not tested SHI-O Protein 8e-22 99
Z1661 NP_287163.1 hypothetical protein Not tested TAI Protein 2e-22 99
tnpE AAD44738.1 TnpE Not tested SHI-2 Protein 8e-22 99
ECO103_3584 YP_003223442.1 IS629 transposase OrfA Not tested LEE Protein 5e-22 98
c5168 NP_757016.1 hypothetical protein Not tested PAI II CFT073 Protein 3e-21 98
IS629 CAI43908.1 hypothetical protein 1 Not tested LEE Protein 3e-22 98
c5214 NP_757062.1 hypothetical protein Not tested PAI II CFT073 Protein 3e-21 98
unnamed AAL67399.1 TnpE-like protein Not tested PAI II CFT073 Protein 2e-21 98
S3184 NP_838467.1 IS629 orfA Not tested SHI-1 Protein 3e-21 98
unnamed ADD91740.1 hypothetical protein Not tested PAI-I AL862 Protein 2e-21 98
SF2979 NP_708753.1 IS629 ORF1 Not tested SHI-1 Protein 3e-21 98
ECO111_3720 YP_003236060.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-21 98
ECO111_3775 YP_003236110.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-21 98
IS629 CAC37925.1 hypothetical protein Not tested LEE Protein 3e-22 98
Z4335 NP_289560.1 hypothetical protein Not tested OI-122 Protein 1e-21 98
IS629 CAI43820.1 hypothetical protein Not tested LEE Protein 3e-22 98
SF3706 NP_709445.1 IS629 ORF1 Not tested SHI-2 Protein 1e-21 98
S4062 NP_839231.1 IS629 orfA Not tested SHI-2 Protein 4e-21 98
IS629 CAI43841.1 hypothetical protein Not tested LEE Protein 3e-22 98
unnamed CAD42084.1 hypothetical protein Not tested PAI II 536 Protein 3e-20 97
unnamed AAL67404.1 R13-like protein Not tested PAI II CFT073 Protein 2e-20 96
APECO1_3498 YP_854313.1 transposase; OrfA protein of insertion sequence IS629 Not tested PAI I APEC-O1 Protein 4e-20 96
c3596 NP_755471.1 hypothetical protein Not tested PAI I CFT073 Protein 3e-20 96
c5177 NP_757025.1 hypothetical protein Not tested PAI II CFT073 Protein 3e-20 96
ORF_36 AAZ04445.1 conserved hypothetical protein Not tested PAI I APEC-O1 Protein 3e-20 96
ECUMN_3344 YP_002414020.1 transposase ORF A, IS629 Not tested Not named Protein 3e-20 96
r13 AAC61722.1 R13 Not tested PAI I CFT073 Protein 2e-20 96

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
SBO_4153 YP_410408.1 IS629 ORF1 VFG0606 Protein 3e-22 98
SBO_4153 YP_410408.1 IS629 ORF1 VFG0643 Protein 8e-22 98
SBO_4153 YP_410408.1 IS629 ORF1 VFG1603 Protein 1e-20 97
SBO_4153 YP_410408.1 IS629 ORF1 VFG1717 Protein 8e-21 96