Gene Information

Name : AHA_1825 (AHA_1825)
Accession : -
Strain : Aeromonas hydrophila ATCC 7966
Genome accession: NC_008570
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1989214 - 1989301 bp
Length : 88 bp
Strand : +
Note : -

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGGGTTCGAATCCCTCCCT
CACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 5e-42 97.7
serX - tRNA-Ser Not tested TAI DNA 5e-42 97.7
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 3e-39 95.5
unnamed - tRNA-Ser Not tested VPI-2 DNA 3e-39 95.5
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 3e-39 95.5