
|
Name : CKO_02951 (CKO_02951) Accession : - Strain : Citrobacter koseri ATCC BAA-895 Genome accession: NC_009792 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 2733973 - 2734045 bp Length : 73 bp Strand : - Note : - DNA sequence : GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| APECO1_t04 | - | tRNA-Thr | Not tested | PAI III APEC-O1 | DNA | 3e-34 | 100 |
| unnamed | - | tRNA-Trp | Not tested | Not named | DNA | 6e-25 | 100 |
| thrW | - | tRNA-Thr | Not tested | SHI-O | DNA | 3e-34 | 100 |
| thrW | - | tRNA-Thr | Not tested | PAI III 536 | DNA | 3e-34 | 100 |