Gene Information

Name : Bmul_2271 (Bmul_2271)
Accession : YP_001580453.1
Strain :
Genome accession: NC_010084
Putative virulence/resistance : Resistance
Product : mercuric transport protein periplasmic component
Function : -
COG functional category : P : Inorganic ion transport and metabolism
COG ID : COG2608
EC number : -
Position : 2485297 - 2485581 bp
Length : 285 bp
Strand : +
Note : TIGRFAM: mercuric transport protein periplasmic component; PFAM: Heavy metal transport/detoxification protein; KEGG: ajs:Ajs_1476 mercuric transport protein periplasmic component

DNA sequence :
GTGAAAAAACTCGTTGCCCTGGCGGCGTTGGCCGCGATGACCTCGCCCGTCTGGGCTGCCACCCAGAGCGTCACGCTGTC
CGTGCCGGGCATGAACTGCGCCACTTGCCCGATCACGGTCAAGAAAGCGCTGACCAAGGTTTCCGGCGTCAGCAAGATCG
ACGTGAGCCTGGATCGACGTGAGGCTAGGGTCACGTTCGATGATGCGAAGGCGAACGTCGAGGCCCTCACACGCGCCACA
AAGGACGCAGGTTTTCCGTCCACTTTGGTGGGAGCCGCCAAATGA

Protein sequence :
MKKLVALAALAAMTSPVWAATQSVTLSVPGMNCATCPITVKKALTKVSGVSKIDVSLDRREARVTFDDAKANVEALTRAT
KDAGFPSTLVGAAK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
merP CAJ77062.1 Periplasmic mercuric ion binding protein Not tested AbaR1 Protein 2e-20 74
merP ACN81007.1 MerP periplasmic mercuric ion binding protein Not tested AbaR5 Protein 2e-20 74
merP YP_006098389.1 mercuric ion transport protein Not tested Tn2411 Protein 1e-20 70
merP ABQ57373.1 MerP Not tested SGI1 Protein 8e-21 70
merP AET25399.1 MerP Not tested PAGI-2(C) Protein 8e-21 70
merP AFG30122.1 MerP Not tested PAGI-2 Protein 8e-21 70
merP AGK07023.1 MerP Not tested SGI1 Protein 8e-21 70
merP AGK07081.1 MerP Not tested SGI1 Protein 8e-21 70
unnamed ABR13399.1 copper-transporting ATPase 2 Not tested PAGI-5 Protein 5e-23 69
merP AAN62179.1 periplasmic mercuric ion binding protein MerP Not tested PAGI-2(C) Protein 4e-19 66

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
Bmul_2271 YP_001580453.1 mercuric transport protein periplasmic component BAC0679 Protein 1e-19 70
Bmul_2271 YP_001580453.1 mercuric transport protein periplasmic component BAC0678 Protein 3e-20 68
Bmul_2271 YP_001580453.1 mercuric transport protein periplasmic component BAC0675 Protein 4e-19 68
Bmul_2271 YP_001580453.1 mercuric transport protein periplasmic component BAC0231 Protein 2e-20 67
Bmul_2271 YP_001580453.1 mercuric transport protein periplasmic component BAC0674 Protein 2e-19 57