Gene Information

Name : SGt16 (SGt16)
Accession : -
Strain : Salmonella enterica 287/91
Genome accession: NC_011274
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 960435 - 960519 bp
Length : 85 bp
Strand : -
Note : tRNA Ser anticodon GGA, Cove score 53.14

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGGGGGTTCGAATCCCCCCCT
CACCG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serX - tRNA-Ser Not tested TAI DNA 7e-42 100
serW - tRNA-Ser Not tested TAI DNA 7e-42 100
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9
unnamed - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9