Name : ECH74115_5038 (ECH74115_5038) Accession : - Strain : Escherichia coli EC4115 Genome accession: NC_011353 Putative virulence/resistance : Unknown Product : - Function : - COG functional category : - COG ID : - EC number : - Position : 4687784 - 4687981 bp Length : 198 bp Strand : + Note : conserved hypothetical protein; this gene contains a premature stop which may be the result of sequencing error; identified by match to protein family HMM PF06117 DNA sequence : ATGACATCATTAACCCCGGAAGCAGCACTGGATATTCTGATTGCGTGGCTGCAGGACAATATCGACAGCGAATCCGGAAT TATCTTCGACAACGATGAGGATAAAACGGATTCGGCAGCATTGTTGCCCTGTATCGAACAGGTCAGGGAAGATGTCCGTA CCCTGCGCCAACTGCAGCTTCTGCAACAGAACCGGTGA Protein sequence : - |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
Z5093 | NP_290244.1 | hypothetical protein | Not tested | LEE | DNA | e-108 | 100 |
ECs4541 | NP_312568.1 | hypothetical protein | Not tested | LEE | DNA | e-108 | 100 |
unnamed | ACU09435.1 | conserved hypothetical protein | Not tested | LEE | DNA | e-108 | 100 |
unnamed | AAC31488.1 | L0009 | Not tested | LEE | DNA | e-108 | 100 |
unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | DNA | 1e-81 | 93 |
SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | DNA | 1e-81 | 93 |
aec78 | AAW51761.1 | Aec78 | Not tested | AGI-3 | DNA | 2e-93 | 92.4 |
z1225 | CAD33791.1 | Z1225 protein | Not tested | PAI I 536 | DNA | 5e-94 | 92.4 |
unnamed | AAL08480.1 | unknown | Not tested | SRL | DNA | 9e-92 | 91.9 |
Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | DNA | 9e-92 | 91.9 |
Z1663 | NP_287165.1 | hypothetical protein | Not tested | TAI | DNA | 9e-92 | 91.9 |
unnamed | ADD91697.1 | hypothetical conserved protein | Not tested | PAI-I AL862 | DNA | 3e-92 | 91.9 |
unnamed | CAI43850.1 | hypothetical protein | Not tested | LEE | DNA | 1e-91 | 91.9 |
unnamed | CAD66209.1 | hypothetical protein | Not tested | PAI III 536 | DNA | 6e-92 | 91.4 |
unnamed | CAI43905.1 | hypothetical protein | Not tested | LEE | DNA | 2e-91 | 91.4 |
unnamed | CAD42103.1 | hypothetical protein | Not tested | PAI II 536 | DNA | 2e-90 | 91.4 |
unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | DNA | 1e-89 | 90.9 |
c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | DNA | 1e-89 | 90.9 |
unnamed | AAL57573.1 | unknown | Not tested | LEE | DNA | 1e-90 | 90.9 |
ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | DNA | 8e-90 | 90.4 |
ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | DNA | 6e-87 | 89.9 |
unnamed | CAE85206.1 | hypothetical protein | Not tested | PAI V 536 | DNA | 4e-86 | 89.4 |