Gene Information

Name : Tmz1t_2104 (Tmz1t_2104)
Accession : YP_002355741.1
Strain : Thauera sp. MZ1T
Genome accession: NC_011662
Putative virulence/resistance : Resistance
Product : MerR family transcriptional regulator
Function : -
COG functional category : K : Transcription
COG ID : COG0789
EC number : -
Position : 2380018 - 2380473 bp
Length : 456 bp
Strand : +
Note : KEGG: dar:Daro_2633 Cd(II)/Pb(II)-responsive transcriptional regulator; TIGRFAM: Cd(II)/Pb(II)-responsive transcriptional regulator; PFAM: transcription regulator MerR DNA binding; regulatory protein MerR; SMART: regulatory protein MerR

DNA sequence :
ATGAAAATCGGTGAGCTGGCCAGAGTGACCGGCACCCCGGTAGAGACCATCCGCTACTACGAGCGCGAAGGGTTGCTGGC
CGCCCCGGCACGTACGGACGGCAATTTCCGCATCTACGAGGACACCCACGCCGAGCGTTTGTCGTTCATCCGCCATTGCC
GATCGCTGGACATGTCGTTGGACGAGATTCGCATCCTGCTGCGCTTCAAGGATGCGCCGGGCGCGAACTGCGGCGATGTG
AACACGTTGCTCGATGCTCACATCGTTCACGTCGCGGCACGTATCCGCGAACTGCGTGTGCTGGAGCGGCAACTCAAGAG
CCTGCGCGAACAATGTCCCCAGGCACGGGATGCTGCCCACTGTGGCATCCTGCACGAGTTGTCACAGCCCGCGTGTCCGG
GAGCACCTATCAGTGGCGGGCACGTGCATGGCGCGCACGGCGGCGTCCGAAAATGA

Protein sequence :
MKIGELARVTGTPVETIRYYEREGLLAAPARTDGNFRIYEDTHAERLSFIRHCRSLDMSLDEIRILLRFKDAPGANCGDV
NTLLDAHIVHVAARIRELRVLERQLKSLREQCPQARDAAHCGILHELSQPACPGAPISGGHVHGAHGGVRK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 5e-36 54
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 7e-34 49
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 1e-33 49
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 8e-34 49
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 7e-34 49
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 7e-34 49
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 5e-34 49
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 5e-34 49

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
Tmz1t_2104 YP_002355741.1 MerR family transcriptional regulator BAC0301 Protein 1e-31 59
Tmz1t_2104 YP_002355741.1 MerR family transcriptional regulator BAC0058 Protein 1e-36 56