
|
Name : ECS88_tRNA47 (ECS88_tRNA47) Accession : - Strain : Escherichia coli S88 Genome accession: NC_011742 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 4411511 - 4411586 bp Length : 76 bp Strand : + Note : Evidence 2a : Function of homologous gene experimentally demonstrated in an other organism; Product type n : RNA DNA sequence : GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATTCCGGTAGTCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| BJAB07104_tRNA9 | - | tRNA-Thr | Not tested | AbaR25 | DNA | 6e-19 | 92.9 |
| BJAB0868_tRNA9 | - | tRNA-Thr | Not tested | AbaR26 | DNA | 6e-19 | 92.9 |