Gene Information

Name : ccmD (EC55989_2451)
Accession : YP_002403477.1
Strain : Escherichia coli 55989
Genome accession: NC_011748
Putative virulence/resistance : Unknown
Product : cytochrome c biogenesis protein
Function : -
COG functional category : U : Intracellular trafficking, secretion and vesicular transport
COG ID : COG3114
EC number : -
Position : 2509403 - 2509612 bp
Length : 210 bp
Strand : -
Note : Evidence 1b : Function experimentally demonstrated in the studied species; PubMedId : 10339610, 12196152, 95362656, 9716493, 7635817; Product type f : factor

DNA sequence :
ATGACCCCTGCATTTGCTTCCTGGAATGAATTTTTCGCAATGGGCGGTTACGCCTTTTTTGTCTGGCTGGCGGTGGTGAT
GACCGTTATTCCGCTGGTGGTTTTGGTCGTGCACTCGGTGATGCAGCATCGCGCAATTCTGCGTGGTGTGGCGCAACAGC
GGGCGCGTGAGGCGCGTTTACGTGCTGCGCAACAGCAGGAGGCTGCATGA

Protein sequence :
MTPAFASWNEFFAMGGYAFFVWLAVVMTVIPLVVLVVHSVMQHRAILRGVAQQRAREARLRAAQQQEAA

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ccmD YP_217243.1 heme exporter protein C, cytochrome c-type biogenesis protein Not tested SPI-12 Protein 9e-08 74