Name : ECIAI39_4568 (ECIAI39_4568) Accession : YP_002410433.1 Strain : Escherichia coli IAI39 Genome accession: NC_011750 Putative virulence/resistance : Virulence Product : hypothetical protein Function : - COG functional category : - COG ID : - EC number : - Position : 4773874 - 4774122 bp Length : 249 bp Strand : - Note : Evidence 4 : Homologs of previously reported genes of unknown function DNA sequence : ATGTCTGCCGGGTCTGCCCACTTTCGACTGGTAATCAGGGAAATTCACAACATGAAATCATTAACGACAGAAACGGCGCT GGATATTCTGATTGCGTGGCTGCAGGACAATATCGACTGTGAATCCGGGATTATCTTCGACAACGATGAGGATAAGACGG ATTCAGCAGCACTGTTGCCCTGCATCGAACAGGCCCGGGAGGATGTCCGTGCTGTTCGTCATCTGCAGCTTCTGCACCAG AACCGGTGA Protein sequence : MSAGSAHFRLVIREIHNMKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDVRAVRHLQLLHQ NR |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
ECO111_3780 | YP_003236115.1 | hypothetical protein | Not tested | LEE | Protein | 1e-23 | 97 |
unnamed | AAL08480.1 | unknown | Not tested | SRL | Protein | 2e-23 | 96 |
Z1225 | NP_286759.1 | hypothetical protein | Not tested | TAI | Protein | 3e-23 | 96 |
unnamed | AAL67387.1 | L0009-like protein | Not tested | PAI II CFT073 | Protein | 4e-23 | 94 |
c5147 | NP_756995.1 | hypothetical protein | Not tested | PAI II CFT073 | Protein | 5e-23 | 94 |
ECO103_3594 | YP_003223451.1 | hypothetical protein | Not tested | LEE | Protein | 8e-22 | 91 |
unnamed | CAD42103.1 | hypothetical protein | Not tested | PAI II 536 | Protein | 8e-28 | 90 |
unnamed | AAK00484.1 | unknown | Not tested | SHI-1 | Protein | 7e-22 | 90 |
SF3001 | NP_708775.1 | hypothetical protein | Not tested | SHI-1 | Protein | 1e-21 | 90 |
Z1663 | NP_287165.1 | hypothetical protein | Not tested | TAI | Protein | 1e-27 | 88 |
unnamed | CAE85206.1 | hypothetical protein | Not tested | PAI V 536 | Protein | 9e-27 | 86 |
unnamed | CAI43905.1 | hypothetical protein | Not tested | LEE | Protein | 2e-22 | 86 |
unnamed | ADD91697.1 | hypothetical conserved protein | Not tested | PAI-I AL862 | Protein | 8e-27 | 85 |
unnamed | AAL57573.1 | unknown | Not tested | LEE | Protein | 1e-21 | 85 |
aec78 | AAW51761.1 | Aec78 | Not tested | AGI-3 | Protein | 7e-22 | 85 |
unnamed | CAI43850.1 | hypothetical protein | Not tested | LEE | Protein | 2e-26 | 83 |
z1225 | CAD33791.1 | Z1225 protein | Not tested | PAI I 536 | Protein | 1e-26 | 83 |
unnamed | CAD66209.1 | hypothetical protein | Not tested | PAI III 536 | Protein | 1e-25 | 81 |
Gene | GenBank Accn | Product | ID of source DB | Alignment Type | E-val | Identity |
ECIAI39_4568 | YP_002410433.1 | hypothetical protein | VFG1071 | Protein | 7e-24 | 96 |
ECIAI39_4568 | YP_002410433.1 | hypothetical protein | VFG1622 | Protein | 3e-28 | 90 |
ECIAI39_4568 | YP_002410433.1 | hypothetical protein | VFG0665 | Protein | 3e-22 | 90 |
ECIAI39_4568 | YP_002410433.1 | hypothetical protein | VFG1532 | Protein | 5e-27 | 83 |
ECIAI39_4568 | YP_002410433.1 | hypothetical protein | VFG1684 | Protein | 4e-26 | 81 |