Gene Information

Name : tRNA-Ser (EpC_t60)
Accession : -
Strain : Erwinia pyrifoliae Ep1/96
Genome accession: NC_012214
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1726539 - 1726626 bp
Length : 88 bp
Strand : -
Note : tRNAscan-SE-score 63.75

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGGGTTCGAACCCCTCTCT
CACCACCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 2e-32 97.6
unnamed - tRNA-Ser Not tested VPI-2 DNA 2e-32 97.6
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 2e-32 97.6
serW - tRNA-Ser Not tested TAI DNA 2e-35 96.6
serX - tRNA-Ser Not tested TAI DNA 2e-35 96.6