
|
Name : PC1_R0005 (PC1_R0005) Accession : - Strain : Pectobacterium carotovorum PC1 Genome accession: NC_012917 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 233656 - 233731 bp Length : 76 bp Strand : + Note : - DNA sequence : GCCGGCTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATTCCGGTAGCCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| BJAB07104_tRNA9 | - | tRNA-Thr | Not tested | AbaR25 | DNA | 6e-24 | 89 |
| BJAB0868_tRNA9 | - | tRNA-Thr | Not tested | AbaR26 | DNA | 6e-24 | 89 |