Gene Information

Name : ECBD_0049 (ECBD_0049)
Accession : YP_003034314.1
Strain : Escherichia coli Escherichia coli BL21-Gold(DE3)pLysS AG
Genome accession: NC_012947
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 49272 - 49469 bp
Length : 198 bp
Strand : -
Note : PFAM: protein of unknown function DUF957; KEGG: sfl:SF3001 hypothetical protein

DNA sequence :
ATGAAATCATTAACCACGGAAACAGCACTGGATATTCTGATTGCGTGGCTGCAGGACAATATCGACTGCGAATCGGGAAT
TATCTTTGACAACGATGAGGATAAAACGGATTCGGCAGCACTGCTGCCCTGCATTGAACAGGCGAGGGAGGATATCCATA
CCCTGCGCCAACTGCAGCTTCTGCAACAGAACCGGTGA

Protein sequence :
MKSLTTETALDILIAWLQDNIDCESGIIFDNDEDKTDSAALLPCIEQAREDIHTLRQLQLLQQNR

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ECO103_3594 YP_003223451.1 hypothetical protein Not tested LEE Protein 1e-17 99
SF3001 NP_708775.1 hypothetical protein Not tested SHI-1 Protein 5e-17 97
ECO111_3780 YP_003236115.1 hypothetical protein Not tested LEE Protein 1e-17 97
unnamed AAK00484.1 unknown Not tested SHI-1 Protein 4e-17 97
unnamed AAL08480.1 unknown Not tested SRL Protein 2e-17 95
Z1225 NP_286759.1 hypothetical protein Not tested TAI Protein 3e-17 95
unnamed AAL67387.1 L0009-like protein Not tested PAI II CFT073 Protein 3e-17 93
c5147 NP_756995.1 hypothetical protein Not tested PAI II CFT073 Protein 4e-17 93
unnamed AAC31488.1 L0009 Not tested LEE Protein 5e-16 88
unnamed ACU09435.1 conserved hypothetical protein Not tested LEE Protein 5e-16 88
Z5093 NP_290244.1 hypothetical protein Not tested LEE Protein 7e-16 88
ECs4541 NP_312568.1 hypothetical protein Not tested LEE Protein 7e-16 88

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
ECBD_0049 YP_003034314.1 hypothetical protein VFG0665 Protein 2e-17 97
ECBD_0049 YP_003034314.1 hypothetical protein VFG1071 Protein 8e-18 95
ECBD_0049 YP_003034314.1 hypothetical protein VFG0788 Protein 2e-16 88