Gene Information

Name : serW (ECB_t00022)
Accession : -
Strain : Escherichia coli REL606
Genome accession: NC_012967
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 942943 - 943030 bp
Length : 88 bp
Strand : -
Note : -

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGGGGGTTCGAATCCCCCCCT
CACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 1e-43 100
serX - tRNA-Ser Not tested TAI DNA 1e-43 100
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2
unnamed - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2