
|
Name : Pecwa_R0051 (Pecwa_R0051) Accession : - Strain : Pectobacterium wasabiae WPP163 Genome accession: NC_013421 Putative virulence/resistance : Unknown Product : tRNA-Ser Function : - COG functional category : - COG ID : - EC number : - Position : 2267346 - 2267435 bp Length : 90 bp Strand : - Note : - DNA sequence : GGTGAGGTGTCCGAGAGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGTGAAAACGTATCAAGGGTTCGAATCCCTTC CTCACCGCCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| serX | - | tRNA-Ser | Not tested | TAI | DNA | 1e-19 | 94.2 |
| serW | - | tRNA-Ser | Not tested | TAI | DNA | 1e-19 | 94.2 |
| VC0395_A1356 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 91.9 |
| unnamed | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 91.9 |
| tRNA-Ser-2 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 3e-18 | 91.9 |