Gene Information

Name : Pecwa_R0072 (Pecwa_R0072)
Accession : -
Strain : Pectobacterium wasabiae WPP163
Genome accession: NC_013421
Putative virulence/resistance : Unknown
Product : tRNA-Thr
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3764502 - 3764577 bp
Length : 76 bp
Strand : -
Note : -

DNA sequence :
GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed - tRNA-Trp Not tested Not named DNA 6e-25 100
thrW - tRNA-Thr Not tested PAI III 536 DNA 4e-36 100
APECO1_t04 - tRNA-Thr Not tested PAI III APEC-O1 DNA 3e-34 100
thrW - tRNA-Thr Not tested SHI-O DNA 4e-36 100