Gene Information

Name : Dd586_0411 (Dd586_0411)
Accession : YP_003332012.1
Strain : Dickeya dadantii Ech586
Genome accession: NC_013592
Putative virulence/resistance : Virulence
Product : hypothetical protein
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 468218 - 468538 bp
Length : 321 bp
Strand : +
Note : PFAM: protein of unknown function DUF1219; KEGG: dze:Dd1591_0933 protein of unknown function DUF1219

DNA sequence :
ATGCAAACACCATCCCCATCCCCGGCGCGGGAGGCATCGTCATGCCTGTCACCTGTGAGTGTCTGGCAACAGTTATTAAC
TTACCTGCTGGACAAGCACTACGGGCTGACGCTCAACGACACGCCGTTTTGCGAGGAAGCCGAGATTCAGGCCCACCTCG
ACGCAGGAGTTTCGCTGCCGGACGCCGTGAACTTTCTGGTGGAGCGCTATGAACTGGTGCGTATCGATCGCAGCGGTTTT
AGCTGGCAGGAGCAAAAACCGTTTCTGAACGCGGTCGATATTCTCCGCGCCAGACGGGCCACCGGCCTGCTCAAACCATA
A

Protein sequence :
MQTPSPSPAREASSCLSPVSVWQQLLTYLLDKHYGLTLNDTPFCEEAEIQAHLDAGVSLPDAVNFLVERYELVRIDRSGF
SWQEQKPFLNAVDILRARRATGLLKP

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed CAD66207.1 hypothetical protein Not tested PAI III 536 Protein 6e-27 63
unnamed AAL57575.1 unknown Not tested LEE Protein 1e-26 63
ECO103_3592 YP_003223449.1 hypothetical protein Not tested LEE Protein 5e-27 62
unnamed AAL67342.1 intergenic-region protein Not tested PAI II CFT073 Protein 2e-26 62
unnamed CAD42101.1 hypothetical protein Not tested PAI II 536 Protein 2e-26 62
yeeV YP_854325.1 hypothetical protein Not tested PAI I APEC-O1 Protein 4e-27 61
yeeV CAE85204.1 YeeV protein Not tested PAI V 536 Protein 2e-26 61
unnamed AAL08478.1 unknown Not tested SRL Protein 1e-25 61
unnamed CAI43848.1 hypothetical protein Not tested LEE Protein 4e-26 61
aec76 AAW51759.1 Aec76 Not tested AGI-3 Protein 4e-26 61
z5091 CAD33789.1 Z5091 protein Not tested PAI I 536 Protein 5e-26 60
unnamed AAK00482.1 unknown Not tested SHI-1 Protein 3e-27 60
yeeV NP_838487.1 hypothetical protein Not tested SHI-1 Protein 5e-27 60
yeeV NP_708773.1 hypothetical protein Not tested SHI-1 Protein 5e-27 60
unnamed AAL67389.1 L0007-like protein Not tested PAI II CFT073 Protein 1e-25 60
c5149 NP_756997.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-25 60
unnamed AAC31486.1 L0007 Not tested LEE Protein 1e-25 60
Z5091 NP_290242.1 hypothetical protein Not tested LEE Protein 2e-25 60
unnamed ACU09433.1 conserved hypothetical protein Not tested LEE Protein 1e-25 60
ECs4539 NP_312566.1 hypothetical protein Not tested LEE Protein 2e-25 60
yeeV ADD91699.1 YeeV Not tested PAI-I AL862 Protein 2e-25 60

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
Dd586_0411 YP_003332012.1 hypothetical protein VFG1682 Protein 2e-27 63
Dd586_0411 YP_003332012.1 hypothetical protein VFG1620 Protein 8e-27 62
Dd586_0411 YP_003332012.1 hypothetical protein VFG1069 Protein 4e-26 61
Dd586_0411 YP_003332012.1 hypothetical protein VFG1530 Protein 2e-26 60
Dd586_0411 YP_003332012.1 hypothetical protein VFG0663 Protein 1e-27 60
Dd586_0411 YP_003332012.1 hypothetical protein VFG0786 Protein 5e-26 60