Gene Information

Name : THI_3119 (THI_3119)
Accession : YP_003625502.1
Strain : Thiomonas sp. 3As
Genome accession: NC_014145
Putative virulence/resistance : Resistance
Product : putative Bacterial regulatory protein, MerR family
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 3040609 - 3041037 bp
Length : 429 bp
Strand : -
Note : Evidence 3 : Function proposed based on presence of conserved amino acid motif, structural feature or limited homology; Product type pr : putative regulator

DNA sequence :
ATGCGAATCGGGGAATTGGCGCGGCGCGGCCACTGCGACGTGGAGACGGTGCGTTTTTACGAGCGCGAGGGCTTGCTGGA
CGCGCCCGCCCGCGAGGGCAACGGCTATCGCAACTACACCAATGACCACCTGGTGCAGCTCAACTTCATTCGTCACTGCC
GCTCGCTGGGCATGGGATTGCCGGACGCGCGCGTGTTGCGCAGCTTTCAGGAGCATCCTGAATCGGCGTGCGGCGCCATC
AACCAGTTGATCGACCGGCAGATCGCGCGTATCCACCATCAAGTCGAATCGCTGCGCCTGCTGGAGCAGCAGTTGCACGC
GCTGCGCGAAACCTGCCAGGCCAATCGAACCGCGGGCGCATGCGGCATCATGCAGAACCTGCAGCACGCTGCGGCTGGCG
AGCCCTGCGAATGCCATGCGGAACCCTAG

Protein sequence :
MRIGELARRGHCDVETVRFYEREGLLDAPAREGNGYRNYTNDHLVQLNFIRHCRSLGMGLPDARVLRSFQEHPESACGAI
NQLIDRQIARIHHQVESLRLLEQQLHALRETCQANRTAGACGIMQNLQHAAAGEPCECHAEP

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
ORF C98 AAN62191.1 putative transcriptional regulator Not tested PAGI-2(C) Protein 2e-29 46
cadR ADZ05769.1 MerR family transcriptional regulator Not tested AbaR11 Protein 2e-30 42
cadR ACS32041.1 MerR family transcriptional regulator Not tested AbaR5 Protein 3e-30 42
ACICU_00234 YP_001844893.1 transcriptional regulator Not tested AbaR20 Protein 2e-30 42
pbrR CAJ77094.1 Transcriptional regulator Not tested AbaR1 Protein 1e-30 42
cadR AGK36653.1 MerR family transcriptional regulator Not tested AbaR26 Protein 1e-30 42
cadR ACN81029.1 MerR family transcriptional regulator Not tested AbaR5 Protein 2e-30 42
pbrR CAJ77021.1 transcription regulator Not tested AbaR1 Protein 2e-30 42

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
THI_3119 YP_003625502.1 putative Bacterial regulatory protein, MerR family BAC0301 Protein 9e-25 45
THI_3119 YP_003625502.1 putative Bacterial regulatory protein, MerR family BAC0058 Protein 9e-30 44