Gene Information

Name : merP (NIDE0066)
Accession : YP_003795782.1
Strain : Candidatus Nitrospira defluvii
Genome accession: NC_014355
Putative virulence/resistance : Resistance
Product : periplasmic mercury ion binding protein
Function : -
COG functional category : P : Inorganic ion transport and metabolism
COG ID : COG2608
EC number : -
Position : 55641 - 55925 bp
Length : 285 bp
Strand : +
Note : Evidence 2b : Function of strongly homologous gene; PubMedId : 15123428, 1555597, 2666393, 9167257, 9188683, 9649312; Product type t : transporter

DNA sequence :
GTGAAAAAACTCGTTGCCCTGGCGGCGTTGGCCGCGATGACCTCGCCCGTCTGGGCTGCCACCCAGAGCGTCACGCTGTC
CGTGCCGGGCATGAACTGCGCCACTTGCCCGATCACGGTCAAGAAAGCGCTGACCAAGGTTTCCGGCGTCAGCAAGATCG
ACGTGAGCCTGGATCGACGTGAGGCCAGGGTCACGTTCGATGATGCGAAGGCGAACGTCGAGGCCCTCACACGCGCCACC
AAGGACGCAGGTTTTCCGTCCACTTTGGTGGGAGCCGCCAAATGA

Protein sequence :
MKKLVALAALAAMTSPVWAATQSVTLSVPGMNCATCPITVKKALTKVSGVSKIDVSLDRREARVTFDDAKANVEALTRAT
KDAGFPSTLVGAAK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
merP ACN81007.1 MerP periplasmic mercuric ion binding protein Not tested AbaR5 Protein 2e-20 74
merP CAJ77062.1 Periplasmic mercuric ion binding protein Not tested AbaR1 Protein 2e-20 74
merP AET25399.1 MerP Not tested PAGI-2(C) Protein 8e-21 70
merP AFG30122.1 MerP Not tested PAGI-2 Protein 8e-21 70
merP AGK07023.1 MerP Not tested SGI1 Protein 8e-21 70
merP AGK07081.1 MerP Not tested SGI1 Protein 8e-21 70
merP YP_006098389.1 mercuric ion transport protein Not tested Tn2411 Protein 1e-20 70
merP ABQ57373.1 MerP Not tested SGI1 Protein 8e-21 70
unnamed ABR13399.1 copper-transporting ATPase 2 Not tested PAGI-5 Protein 5e-23 69
merP AAN62179.1 periplasmic mercuric ion binding protein MerP Not tested PAGI-2(C) Protein 4e-19 66

• Homologs from CARD and BacMet (resistance genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
merP YP_003795782.1 periplasmic mercury ion binding protein BAC0679 Protein 1e-19 70
merP YP_003795782.1 periplasmic mercury ion binding protein BAC0675 Protein 4e-19 68
merP YP_003795782.1 periplasmic mercury ion binding protein BAC0678 Protein 3e-20 68
merP YP_003795782.1 periplasmic mercury ion binding protein BAC0231 Protein 2e-20 67
merP YP_003795782.1 periplasmic mercury ion binding protein BAC0674 Protein 2e-19 57