
|
Name : Selsp_R0004 (Selsp_R0004) Accession : - Strain : Selenomonas sputigena ATCC 35185 Genome accession: NC_015437 Putative virulence/resistance : Unknown Product : tRNA-Ser Function : - COG functional category : - COG ID : - EC number : - Position : 126969 - 127060 bp Length : 92 bp Strand : + Note : IMG reference gene:2504585567 DNA sequence : GGAGAGTTGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGCGTGTATACGGGGAAACCTGTATCGAGAGTTCGAATCTCT CACTCTCCGCCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| SAtRNA19 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 7e-06 | 95.7 |
| SAVtRNA17 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 7e-06 | 95.7 |
| SAMSHR1132_t09 | - | tRNA-Ser | Not tested | vSa¥â | DNA | 7e-06 | 95.7 |
| VC0395_A1356 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 1e-18 | 95.2 |
| unnamed | - | tRNA-Ser | Not tested | VPI-2 | DNA | 1e-18 | 95.2 |
| tRNA-Ser-2 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 1e-18 | 95.2 |