Gene Information

Name : EAE_06635 (EAE_06635)
Accession : YP_004591530.1
Strain : Enterobacter aerogenes KCTC 2190
Genome accession: NC_015663
Putative virulence/resistance : Virulence
Product : CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1378708 - 1379028 bp
Length : 321 bp
Strand : +
Note : -

DNA sequence :
ATGAATACTCAACCTGCAACAACTCCGCAGGCGGCGAAGCCATGTCTGTCGCCCCTGGCTGTCTGGAAAATGTTACTGAC
AATCCTGCTAGACCAGCACTATGGTCTCACGCTAAACGACACGCCGTTCAGTGATGAAACTGTTATTCAGAAACACATTG
AGGCAGGTATTACCTTGGCTGATGCCATAAATTTTCTGGTTGAACGCTATGAACTAGTTCGTATTGACCAAAAAGGCTTC
TCTGTGCAAGATCAAGAACCTTGGTTAACTTCTATGGATGTCCACCGAGCACGATTTAAACTCAACGTGGAACGTTTATA
A

Protein sequence :
MNTQPATTPQAAKPCLSPLAVWKMLLTILLDQHYGLTLNDTPFSDETVIQKHIEAGITLADAINFLVERYELVRIDQKGF
SVQDQEPWLTSMDVHRARFKLNVERL

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
yeeV NP_838487.1 hypothetical protein Not tested SHI-1 Protein 3e-25 62
yeeV NP_708773.1 hypothetical protein Not tested SHI-1 Protein 3e-25 62
unnamed CAD42101.1 hypothetical protein Not tested PAI II 536 Protein 5e-25 62
yeeV CAE85204.1 YeeV protein Not tested PAI V 536 Protein 4e-25 62
unnamed CAD66207.1 hypothetical protein Not tested PAI III 536 Protein 2e-25 62
unnamed AAK00482.1 unknown Not tested SHI-1 Protein 2e-25 62
yeeV YP_854325.1 hypothetical protein Not tested PAI I APEC-O1 Protein 3e-25 62
unnamed AAL67342.1 intergenic-region protein Not tested PAI II CFT073 Protein 7e-25 61
unnamed AAL57575.1 unknown Not tested LEE Protein 4e-25 61
ECO103_3592 YP_003223449.1 hypothetical protein Not tested LEE Protein 5e-25 61
Z5091 NP_290242.1 hypothetical protein Not tested LEE Protein 3e-24 60
ECs4539 NP_312566.1 hypothetical protein Not tested LEE Protein 3e-24 60
unnamed AAC31486.1 L0007 Not tested LEE Protein 2e-24 60
unnamed ACU09433.1 conserved hypothetical protein Not tested LEE Protein 2e-24 60
unnamed CAI43848.1 hypothetical protein Not tested LEE Protein 2e-24 59
aec76 AAW51759.1 Aec76 Not tested AGI-3 Protein 2e-24 59
z5091 CAD33789.1 Z5091 protein Not tested PAI I 536 Protein 4e-24 59
unnamed AAL08478.1 unknown Not tested SRL Protein 3e-23 58
yeeV ADD91699.1 YeeV Not tested PAI-I AL862 Protein 5e-24 58
c5149 NP_756997.1 hypothetical protein Not tested PAI II CFT073 Protein 7e-24 58
unnamed AAL67389.1 L0007-like protein Not tested PAI II CFT073 Protein 5e-24 58

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG1620 Protein 2e-25 62
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG0663 Protein 8e-26 62
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG1682 Protein 9e-26 62
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG0786 Protein 1e-24 60
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG1530 Protein 2e-24 59
EAE_06635 YP_004591530.1 CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system VFG1069 Protein 1e-23 58