|
Name : tRNA_022 (tRNA_022) Accession : - Strain : Zobellia galactanivorans DsiJT Genome accession: NC_015844 Putative virulence/resistance : Unknown Product : tRNA-Asp Function : - COG functional category : - COG ID : - EC number : - Position : 2548812 - 2548888 bp Length : 77 bp Strand : + Note : Gene encoding for a Aspartic acid tRNA with the anticodon sequence GUC (35-37); tRNA is the information adapter molecule. It is the direct interface between amino-acid sequence of a protein and the information in DNA. All have between 75-95 nucleotides; T DNA sequence : GGTCTGGTAGTTCAGTTGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAGTCCCGTCCAGACCGCGA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| unnamed | - | tRNA-Asp | Not tested | SPI-6 | DNA | 1e-28 | 100 |
| APECO1_t03 | - | tRNA-Asp | Not tested | PAI II APEC-O1 | DNA | 6e-28 | 98.4 |
| unnamed | - | tRNA-Asx | Not tested | tcd island | DNA | 2e-25 | 95.2 |
