
|
Name : trnaS (Vch1786_I1252) Accession : - Strain : Genome accession: NC_016445 Putative virulence/resistance : Unknown Product : tRNA-Ser Function : - COG functional category : - COG ID : - EC number : - Position : 1367093 - 1367180 bp Length : 88 bp Strand : + Note : tRNA created by Simple tRNAscan Autoannotator. Ser tRNA (anticodon: GGA (35-37)). DNA sequence : GGTGAGTTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGAGAGTTCGAATCTCTCACT CACCGCCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| VC0395_A1356 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 2e-43 | 100 |
| unnamed | - | tRNA-Ser | Not tested | VPI-2 | DNA | 2e-43 | 100 |
| tRNA-Ser-2 | - | tRNA-Ser | Not tested | VPI-2 | DNA | 2e-43 | 100 |
| serX | - | tRNA-Ser | Not tested | TAI | DNA | 9e-38 | 93.2 |
| serW | - | tRNA-Ser | Not tested | TAI | DNA | 9e-38 | 93.2 |