
|
Name : YPD8_t11 (YPD8_t11) Accession : - Strain : Yersinia pestis D182038 Genome accession: NC_017160 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 1375813 - 1375888 bp Length : 76 bp Strand : - Note : - DNA sequence : GCCGGCATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCCGAGTTCGACTCTTGGTGCCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| BJAB07104_tRNA9 | - | tRNA-Thr | Not tested | AbaR25 | DNA | 4e-27 | 91.8 |
| BJAB0868_tRNA9 | - | tRNA-Thr | Not tested | AbaR26 | DNA | 4e-27 | 91.8 |