Gene Information

Name : SFxv_5017 (SFxv_5017)
Accession : YP_005712066.1
Strain :
Genome accession: NC_017319
Putative virulence/resistance : Unknown
Product : IS629 orfA
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 141829 - 142104 bp
Length : 276 bp
Strand : +
Note : -

DNA sequence :
ATGGTTCTGGAAAGTCAGGGCGAATATGACTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCC
GGAGACTCTGCGTGTCTGGGGTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCACCACCGCTGAACGTC
AGCGTCTGAAAGAGCCGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACAATATCCTTCGCCTGGCTTCCGCTTATTTT
GCAAAGGCGGAGTTCGACCGCCTCTGGAAAAAATAA

Protein sequence :
MVLESQGEYDSQWATICSIAPKIGCTPETLRVWGRQHERDTGGGDGGLTTAERQRLKEPERENRELRRSNNILRLASAYF
AKAEFDRLWKK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
SF3706 NP_709445.1 IS629 ORF1 Not tested SHI-2 Protein 3e-19 97
unnamed AAF09023.1 unknown Not tested SHI-O Protein 2e-19 96
tnpE AAD44738.1 TnpE Not tested SHI-2 Protein 2e-19 96
unnamed AAL67399.1 TnpE-like protein Not tested PAI II CFT073 Protein 5e-19 95
c5214 NP_757062.1 hypothetical protein Not tested PAI II CFT073 Protein 7e-19 95
unnamed ADD91740.1 hypothetical protein Not tested PAI-I AL862 Protein 5e-19 95
S3184 NP_838467.1 IS629 orfA Not tested SHI-1 Protein 7e-19 95
SF2979 NP_708753.1 IS629 ORF1 Not tested SHI-1 Protein 7e-19 95
S4062 NP_839231.1 IS629 orfA Not tested SHI-2 Protein 9e-19 95
c5168 NP_757016.1 hypothetical protein Not tested PAI II CFT073 Protein 7e-19 95
Z1199 NP_286734.1 hypothetical protein Not tested TAI Protein 8e-20 94
Z1222 NP_286757.1 hypothetical protein Not tested TAI Protein 8e-20 94
Z1639 NP_287142.1 hypothetical protein Not tested TAI Protein 8e-20 94
Z1661 NP_287163.1 hypothetical protein Not tested TAI Protein 8e-20 94
unnamed CAD42084.1 hypothetical protein Not tested PAI II 536 Protein 6e-18 94
ECO111_3720 YP_003236060.1 putative IS629 transposase OrfA Not tested LEE Protein 4e-19 93
IS629 CAC37925.1 hypothetical protein Not tested LEE Protein 1e-19 93
ECO111_3775 YP_003236110.1 putative IS629 transposase OrfA Not tested LEE Protein 4e-19 93
APECO1_3498 YP_854313.1 transposase; OrfA protein of insertion sequence IS629 Not tested PAI I APEC-O1 Protein 9e-18 93
IS629 CAI43820.1 hypothetical protein Not tested LEE Protein 1e-19 93
Z4335 NP_289560.1 hypothetical protein Not tested OI-122 Protein 4e-19 93
IS629 CAI43841.1 hypothetical protein Not tested LEE Protein 1e-19 93
IS629 CAI43908.1 hypothetical protein 1 Not tested LEE Protein 1e-19 93
ORF_36 AAZ04445.1 conserved hypothetical protein Not tested PAI I APEC-O1 Protein 6e-18 93
ECO103_3584 YP_003223442.1 IS629 transposase OrfA Not tested LEE Protein 2e-19 93
c3596 NP_755471.1 hypothetical protein Not tested PAI I CFT073 Protein 2e-17 92
c5177 NP_757025.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-17 92
ECUMN_3344 YP_002414020.1 transposase ORF A, IS629 Not tested Not named Protein 2e-17 92
r13 AAC61722.1 R13 Not tested PAI I CFT073 Protein 1e-17 92
unnamed AAL67404.1 R13-like protein Not tested PAI II CFT073 Protein 1e-17 92

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
SFxv_5017 YP_005712066.1 IS629 orfA VFG0606 Protein 8e-20 97
SFxv_5017 YP_005712066.1 IS629 orfA VFG0643 Protein 2e-19 95
SFxv_5017 YP_005712066.1 IS629 orfA VFG1603 Protein 3e-18 94
SFxv_5017 YP_005712066.1 IS629 orfA VFG1717 Protein 4e-18 92