Gene Information

Name : KPN2242_t24928 (KPN2242_t24928)
Accession : -
Strain : Klebsiella pneumoniae KCTC 2242
Genome accession: NC_017540
Putative virulence/resistance : Unknown
Product : tRNA-Thr
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 834700 - 834772 bp
Length : 73 bp
Strand : -
Note : -

DNA sequence :
GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed - tRNA-Trp Not tested Not named DNA 6e-25 100
APECO1_t04 - tRNA-Thr Not tested PAI III APEC-O1 DNA 3e-34 100
thrW - tRNA-Thr Not tested SHI-O DNA 3e-34 100
thrW - tRNA-Thr Not tested PAI III 536 DNA 3e-34 100