Gene Information

Name : SU5_t44 (SU5_t44)
Accession : -
Strain : Salmonella enterica B182
Genome accession: NC_017623
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1764100 - 1764184 bp
Length : 85 bp
Strand : -
Note : -

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGGGGGTTCGAATCCCCCCCT
CACCG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 7e-42 100
serX - tRNA-Ser Not tested TAI DNA 7e-42 100
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9
unnamed - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 5e-36 92.9