
|
Name : EC042_4581A (EC042_4581A) Accession : YP_006098853.1 Strain : Escherichia coli 042 Genome accession: NC_017626 Putative virulence/resistance : Unknown Product : transposase (partial) Function : - COG functional category : - COG ID : - EC number : - Position : 4915245 - 4915313 bp Length : 69 bp Strand : + Note : Note this CDS carries a frameshift mutation, a premature stop codon and lacks the very C-terminus. DNA sequence : ATGACTAAAAATACTCGTTTTTCCCCCGAAGTTCGTCATAGGGTGATTCGTATAGTTCTGGAAAGTCAG Protein sequence : MTKNTRFSPEVRHRVIRIVLESQGEYDSWAIICSIAPKIGCTPETLRVWGRQHERDTGGGDGGLTTAERQRLKELERENR ELRRSNDILRQAS |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| IS629 | CAC37925.1 | hypothetical protein | Not tested | LEE | Protein | 8e-19 | 92 |
| ECO111_3720 | YP_003236060.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 2e-18 | 92 |
| IS629 | CAI43820.1 | hypothetical protein | Not tested | LEE | Protein | 8e-19 | 92 |
| ECO111_3775 | YP_003236110.1 | putative IS629 transposase OrfA | Not tested | LEE | Protein | 2e-18 | 92 |
| IS629 | CAI43841.1 | hypothetical protein | Not tested | LEE | Protein | 8e-19 | 92 |
| Z4335 | NP_289560.1 | hypothetical protein | Not tested | OI-122 | Protein | 2e-18 | 92 |
| IS629 | CAI43908.1 | hypothetical protein 1 | Not tested | LEE | Protein | 8e-19 | 92 |
| ECO103_3584 | YP_003223442.1 | IS629 transposase OrfA | Not tested | LEE | Protein | 1e-18 | 92 |
| Z1199 | NP_286734.1 | hypothetical protein | Not tested | TAI | Protein | 4e-19 | 92 |
| Z1222 | NP_286757.1 | hypothetical protein | Not tested | TAI | Protein | 4e-19 | 92 |
| Z1639 | NP_287142.1 | hypothetical protein | Not tested | TAI | Protein | 4e-19 | 92 |
| Z1661 | NP_287163.1 | hypothetical protein | Not tested | TAI | Protein | 4e-19 | 92 |