Gene Information

Name : ECOK1_2143 (ECOK1_2143)
Accession : -
Strain : Escherichia coli IHE3034
Genome accession: NC_017628
Putative virulence/resistance : Unknown
Product : -
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2148368 - 2149330 bp
Length : 963 bp
Strand : +
Note : integrase; this gene contains a premature stop which may be the result of a sequencing error; identified by match to protein family HMM PF00589

DNA sequence :
ATGCTGGCGCTGAATATCAACCCGGTACAGCAGCGGGCTGCTGTACGTGGCTCACGAACACCGGAGAAAGTTTTTAAAAA
CGTGGCGCTGGCGTGGCATAAAAGTAACAGGAAATGGTCGCAGAACACCGCCGACCGTCTGCTTGCCAGCCTGAACAATC
ACATCTTTCCGGTCATCGGGAACCTACCTGTATCAGAACTTAAACCCCGTCATTTCATTGACCTGCAGAAAGGGATCGAG
GAAAAAGGTCTGCTGGAGGTTGCGTCCCGCACACGGCAGCACCTGAGTAACATAATACGCCATGCGGTCCATCAGGAGTT
AATCGATACGAACCCTGCAGCAAACCTTGGCGGCGTGACCACACCTCCTGTCAGACGGCACTATCCTGCCCTGCCGCTGG
AGCGGCTGCCTGAACTGCTTGAACGTATTGGGGCATATCATCAGGGCCGTGAACTGACCCGGCATGCCGTTCTGCTGATG
CTGCATGTGTTCATTCGCTCCAGTGAACTGCGTTTCGCCCGCTGGTCAGAGATTGATTTCACAAACCGAGTCTGGACGAT
ACCCGCGACGCGAGAACCCATTATTGGCGTGCATTATTCCGGCCGCGGGGCAAAAATGCGAATGCCGCATATCGTCCCCC
TCTCAGAACAGTCCATCGCCATTCTGAAACAGATTAAGGATATCACCGGTAATAATGAACTGATCTTCCCCGGCGACCAT
AACCCGTATAAGCCAATGTGTGAAAACACGGTCAATAAGGCACTGCGGGTGATGGGTTACGACACGAAAAAGGATATCTG
CGGTCACGGCTTCCGGGCAATGGCATGCAGTGCGCTGATGGAATCGGGTTTATGGGCAAAGGACGCAGTAGAACGCCAGA
TGAGTCATCAGGAGCGCAATACCGTGCGCATGGCTTATATTCATAAGGCAGAGCACCTGGAAGCCCGCAAAGCGATGATG
TAG

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
APECO1_1051 YP_853069.1 phage integrase Not tested PAI IV APEC-O1 DNA 0.0 100
int ACR23166.1 P4-like integrase Not tested HPI DNA 0.0 99.9
int ACR23151.1 P4-like integrase Not tested HPI DNA 0.0 99.9
int ACR23152.1 P4-like integrase Not tested HPI DNA 0.0 99.9
int ACR23162.1 P4-like integrase Not tested HPI DNA 0.0 99.9
int ACR23163.1 P4-like integrase Not tested HPI DNA 0.0 99.9
int ACR23134.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23143.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23135.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23144.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23146.1 P4-like integrase Not tested HPI DNA 0.0 99.6
intB ADN38949.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23147.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23148.1 P4-like integrase Not tested HPI DNA 0.0 99.6
int ACR23142.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38969.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38961.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38953.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23158.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38962.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38954.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23159.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23136.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38963.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38955.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38947.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23153.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23145.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23137.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23129.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38964.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38956.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38948.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23161.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23138.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23130.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23122.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38965.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38957.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23139.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23131.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23123.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38966.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38958.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38950.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23140.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23132.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23124.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38967.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38959.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38951.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23164.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23149.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23141.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23133.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38968.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38960.1 P4-like integrase Not tested HPI DNA 0.0 99.4
intB ADN38952.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int ACR23165.1 P4-like integrase Not tested HPI DNA 0.0 99.4
int CAB59975.1 integrase Not tested HPI DNA 0.0 99.4
YPTB1602 - - Not tested HPI DNA 0.0 99.4
int CAA08754.1 integrase Not tested HPI DNA 0.0 99.4
int ACR23150.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23167.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23154.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23155.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23156.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23125.1 P4-like integrase Not tested HPI DNA 0.0 99.3
int ACR23157.1 P4-like integrase Not tested HPI DNA 0.0 99.3
y2393 NP_669700.1 prophage integrase Not tested HPI DNA 0.0 99.3
int2 NP_993013.1 integrase Not tested HPI DNA 0.0 99.3
int CAA21384.1 - Not tested HPI DNA 0.0 99.3
int YP_002346908.1 integrase Not tested HPI DNA 0.0 99.3
intB AAD37509.1 P4-like integrase Not tested PAI IV 536 DNA 0.0 99.1
int ACR23128.1 P4-like integrase Not tested HPI DNA 0.0 98.9
intB - - Not tested HPI DNA 0.0 98.4
int - - Not tested HPI DNA 0.0 98.4
int - integrase Not tested HPI DNA 0.0 98.3
unnamed AAD17660.1 unknown Not tested HPI DNA 0.0 98.3
int CAB59974.1 integrase Not tested HPI DNA 0.0 97.8
int ACR23127.1 P4-like integrase Not tested HPI DNA 0.0 97.6
int ACR23160.1 P4-like integrase Not tested HPI DNA 0.0 97.3
int ACR23126.1 P4-like integrase Not tested HPI DNA 0.0 97