Gene Information

Name : P12B_c1575 (P12B_c1575)
Accession : YP_006168606.1
Strain : Escherichia coli P12b
Genome accession: NC_017663
Putative virulence/resistance : Unknown
Product : IS629 orfA
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 1697671 - 1697946 bp
Length : 276 bp
Strand : +
Note : -

DNA sequence :
ATGGTTCTGGAAAGTCAGAGCGAATATGACTCACAATGGGCGACAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCC
GGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGAGGGCTCACCACCGCTGAACGTC
AGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTT
GCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGA

Protein sequence :
MVLESQSEYDSQWATICSIAPKIGCTPETLRVWVRQHERDTGGGDGGLTTAERQRLKELERENRELRRSNDILRQASAYF
AKAEFDRLWKK

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
unnamed AAL67399.1 TnpE-like protein Not tested PAI II CFT073 Protein 1e-21 100
SF2979 NP_708753.1 IS629 ORF1 Not tested SHI-1 Protein 2e-21 100
unnamed ADD91740.1 hypothetical protein Not tested PAI-I AL862 Protein 1e-21 100
c5168 NP_757016.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-21 100
c5214 NP_757062.1 hypothetical protein Not tested PAI II CFT073 Protein 2e-21 100
S3184 NP_838467.1 IS629 orfA Not tested SHI-1 Protein 2e-21 100
unnamed AAF09023.1 unknown Not tested SHI-O Protein 1e-21 99
tnpE AAD44738.1 TnpE Not tested SHI-2 Protein 1e-21 99
SF3706 NP_709445.1 IS629 ORF1 Not tested SHI-2 Protein 1e-21 98
S4062 NP_839231.1 IS629 orfA Not tested SHI-2 Protein 6e-21 98
Z1639 NP_287142.1 hypothetical protein Not tested TAI Protein 4e-22 97
Z1661 NP_287163.1 hypothetical protein Not tested TAI Protein 4e-22 97
IS629 CAC37925.1 hypothetical protein Not tested LEE Protein 3e-22 97
ECO111_3720 YP_003236060.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-21 97
IS629 CAI43820.1 hypothetical protein Not tested LEE Protein 3e-22 97
ECO111_3775 YP_003236110.1 putative IS629 transposase OrfA Not tested LEE Protein 1e-21 97
IS629 CAI43841.1 hypothetical protein Not tested LEE Protein 3e-22 97
Z4335 NP_289560.1 hypothetical protein Not tested OI-122 Protein 1e-21 97
IS629 CAI43908.1 hypothetical protein 1 Not tested LEE Protein 3e-22 97
ECO103_3584 YP_003223442.1 IS629 transposase OrfA Not tested LEE Protein 5e-22 97
Z1199 NP_286734.1 hypothetical protein Not tested TAI Protein 4e-22 97
Z1222 NP_286757.1 hypothetical protein Not tested TAI Protein 4e-22 97
c3596 NP_755471.1 hypothetical protein Not tested PAI I CFT073 Protein 3e-20 95
unnamed CAD42084.1 hypothetical protein Not tested PAI II 536 Protein 7e-20 95
c5177 NP_757025.1 hypothetical protein Not tested PAI II CFT073 Protein 3e-20 95
ECUMN_3344 YP_002414020.1 transposase ORF A, IS629 Not tested Not named Protein 3e-20 95
r13 AAC61722.1 R13 Not tested PAI I CFT073 Protein 2e-20 95
unnamed AAL67404.1 R13-like protein Not tested PAI II CFT073 Protein 2e-20 95
APECO1_3498 YP_854313.1 transposase; OrfA protein of insertion sequence IS629 Not tested PAI I APEC-O1 Protein 1e-19 94
ORF_36 AAZ04445.1 conserved hypothetical protein Not tested PAI I APEC-O1 Protein 7e-20 94

• Homologs from VFDB (virulence genes)

GeneGenBank Accn Product ID of source DB Alignment Type E-val Identity
P12B_c1575 YP_006168606.1 IS629 orfA VFG0643 Protein 5e-22 100
P12B_c1575 YP_006168606.1 IS629 orfA VFG0606 Protein 4e-22 98
P12B_c1575 YP_006168606.1 IS629 orfA VFG1603 Protein 3e-20 95
P12B_c1575 YP_006168606.1 IS629 orfA VFG1717 Protein 1e-20 95