Name : BN419_1459 (BN419_1459) Accession : - Strain : Listeria monocytogenes N53-1 Genome accession: NC_020558 Putative virulence/resistance : Unknown Product : tRNA-Arg Function : - COG functional category : - COG ID : - EC number : - Position : 1164453 - 1164526 bp Length : 74 bp Strand : + Note : Predicted by tRNAscan-SE software with a score of 82.37 DNA sequence : GTCCTGATAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGGGGGTTCGAATCCCTCTCAGGACG Protein sequence : - |
Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
tRNA-Arg | - | tRNA-Arg | Not tested | LIPI-2 | DNA | 3e-35 | 100 |
MWtRNA16 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SAUSA300_1066 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SAKOR_r020 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SAtRNA18 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SAVtRNA16 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SACOL_tRNA-Arg-2 | - | tRNA-Arg | Not tested | vSa¥ã | DNA | 4e-32 | 94.6 |
SEt06 | - | tRNA-Arg | Not tested | vSe¥ã | DNA | 4e-32 | 94.6 |
SERP_tRNA-Arg-3 | - | tRNA-Arg | Not tested | vSe¥ã | DNA | 4e-32 | 94.6 |
EFAU085_t001 | - | tRNA-Arg | Not tested | Not named | DNA | 7e-21 | 93.2 |