
|
Name : XAC29_t22065 (XAC29_t22065) Accession : - Strain : Xanthomonas axonopodis Xac29-1 Genome accession: NC_020800 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 1438535 - 1438610 bp Length : 76 bp Strand : + Note : - DNA sequence : GCCGGAATAGCTCAGTTGGTAGAGCGGCGCATTCGTAATGCGTAGGTCGTAGGTTCGATTCCTATTTCCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| APECO1_t04 | - | tRNA-Thr | Not tested | PAI III APEC-O1 | DNA | 1e-23 | 95 |
| thrW | - | tRNA-Thr | Not tested | SHI-O | DNA | 2e-27 | 92.9 |
| thrW | - | tRNA-Thr | Not tested | PAI III 536 | DNA | 2e-27 | 92.9 |