Gene Information

Name : tRNA_Ser(GGA) (TOL_1935)
Accession : -
Strain : Thalassolituus oleivorans MIL-1
Genome accession: NC_020888
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2061304 - 2061393 bp
Length : 90 bp
Strand : -
Note : -

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATAGGTTTATCCCTATCGAGGGTTCGAATCCCTCC
CTCACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serX - tRNA-Ser Not tested TAI DNA 1e-19 97.5
serW - tRNA-Ser Not tested TAI DNA 1e-19 97.5
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 2e-18 95
unnamed - tRNA-Ser Not tested VPI-2 DNA 2e-18 95
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 2e-18 95