
|
Name : J451_07270 (J451_07270) Accession : - Strain : Mannheimia haemolytica D174 Genome accession: NC_021739 Putative virulence/resistance : Unknown Product : tRNA-Thr Function : - COG functional category : - COG ID : - EC number : - Position : 1413985 - 1414060 bp Length : 76 bp Strand : - Note : - DNA sequence : GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATTCCGGTAGTCGGCACCA Protein sequence : - |
| Gene | GenBank Accn | Product | Virulance or Resistance | PAI or REI | Alignment Type | E-val | Identity |
| BJAB07104_tRNA9 | - | tRNA-Thr | Not tested | AbaR25 | DNA | 6e-19 | 92.9 |
| BJAB0868_tRNA9 | - | tRNA-Thr | Not tested | AbaR26 | DNA | 6e-19 | 92.9 |