Gene Information

Name : SN31241_t760 (SN31241_t760)
Accession : -
Strain : Salmonella enterica USMARC-S3124.1
Genome accession: NC_021902
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2011652 - 2011739 bp
Length : 88 bp
Strand : -
Note : Anticodon is GGA

DNA sequence :
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGGGGGTTCGAATCCCCCCCT
CACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 1e-43 100
serX - tRNA-Ser Not tested TAI DNA 1e-43 100
unnamed - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 9e-38 93.2