Gene Information

Name : Ser39006_R0049 (Ser39006_R0049)
Accession : -
Strain : Serratia sp. ATCC 39006
Genome accession: NC_022268
Putative virulence/resistance : Unknown
Product : tRNA-Ser
Function : -
COG functional category : -
COG ID : -
EC number : -
Position : 2696726 - 2696815 bp
Length : 90 bp
Strand : -
Note : -

DNA sequence :
GGTGAGGTGTCCGAGAGGCTTAAGGAGCACGCCTGGAAAGTGTGTATACGTGAAAACGTATCGAGGGTTCGAATCCCTCC
CTCACCGCCA

Protein sequence :
-

• Homologs from PAI DB

GeneGenBank Accn Product Virulance or Resistance PAI or REI Alignment Type E-val Identity
serW - tRNA-Ser Not tested TAI DNA 3e-18 95.3
serX - tRNA-Ser Not tested TAI DNA 3e-18 95.3
VC0395_A1356 - tRNA-Ser Not tested VPI-2 DNA 6e-17 93
unnamed - tRNA-Ser Not tested VPI-2 DNA 6e-17 93
tRNA-Ser-2 - tRNA-Ser Not tested VPI-2 DNA 6e-17 93