PAI Gene Information


Name : serT (STM1086)
Accession : -
PAI name :
PAI accession : NC_003197_P1
Strain :
Virulence or Resistance: Not determined
Product : tRNA-Ser
Function : -
Note : -
Homologs in the searched genomes :   229 hits    ( 229 DNA-level )  
Publication :
    -McClelland,M., Sanderson,K.E., Spieth,J., Clifton,S.W., Latreille,P., Courtney,L., Porwollik,S., Ali,J., Dante,M., Du,F., Hou,S., Layman,D., Leonard,S., Nguyen,C., Scott,K., Holmes,A., Grewal,N., Mulvaney,E., Ryan,E., Sun,H., Florea,L., Miller,W., Stoneki, "Complete genome sequence of Salmonella enterica serovar Typhimurium LT2", Nature 413 (6858), 852-856 (2001) PUBMED 11677609.

    -McClelland,M., Sanderson,K.E., Spieth,J., Clifton,S.W., Latreille,P., Courtney,L., Porwollik,S., Ali,J., Dante,M., Du,F., Hou,S., Layman,D., Leonard,S., Nguyen,C., Scott,K., Holmes,A., Grewal,N., Mulvaney,E., Ryan,E., Sun,H., Florea,L., Miller,W., Stoneki, "Direct Submission", Submitted (10-SEP-2004) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.

    -McClelland,M., Sanderson,K.E., Spieth,J., Clifton,S.W., Latreille,P., Courtney,L., Porwollik,S., Ali,J., Dante,M., Du,F., Hou,S., Layman,D., Leonard,S., Nguyen,C., Scott,K., Holmes,A., Grewal,N., Mulvaney,E., Ryan,E., Sun,H., Florea,L., Miller,W., Stoneki, "Direct Submission", Submitted (06-NOV-2001) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA.


DNA sequence :
GGAAGTGTGGCCGAGCGGTTGAAGGCACCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGC
TTCCGCCA

Protein sequence :
-