PAI Gene Information


Name : unnamed
Accession : AAC33380.1
PAI name : vrl locus
PAI accession : U20246
Strain : Dichelobacter nodosus VCS1703A
Virulence or Resistance: Not determined
Product : unknown
Function : -
Note : ORF28
Homologs in the searched genomes :   No hits  
Publication :
    -Billington,S.J., Huggins,A.S., Johanesen,P.A., Crellin,P.K., Cheung,J.K., Katz,M.E., Wright,C.L., Haring,V. and Rood,J.I., "Complete nucleotide sequence of the 27-kilobase virulence related locus (vrl) of Dichelobacter nodosus: evidence for extrachromosomal origin", Infect. Immun. 67 (3), 1277-1286 (1999) PUBMED 10024571.

    -Haring,V., Billington,S.J., Wright,C.L., Huggins,A.S., Katz,M.E. and Rood,J.I., "Delineation of the virulence-related locus (vrl) of Dichelobacter nodosus", Microbiology 141 (Pt 9), 2081-2089 (1995) PUBMED 7496519.

    -Rood,J.I., "Direct Submission", Submitted (25-JAN-1995) Microbiology, Monash University, Clayton, Victoria 3168, Australia.

    -Rood,J.I., "Direct Submission", Submitted (11-AUG-1997) Microbiology, Monash University, Clayton, Victoria 3168, Australia REMARK Sequence update by submitter.

    -Rood,J.I., "Direct Submission", Submitted (27-AUG-1998) Microbiology, Monash University, Clayton, Victoria 3168, Australia REMARK Sequence update by submitter.


DNA sequence :
GTGACTAAGCGAGTGACCAACTTCGCCGAGCTTGGTCACCCGCAAAGTGACCAAGTTGAGACGCCAGACGAAAGCCAAGG
ATTATGA

Protein sequence :
MTKRVTNFAELGHPQSDQVETPDESQGL