PAI Gene Information


Name : hmbR
Accession : AAK08030.1
PAI name : exl
PAI accession : AF319530
Strain : Neisseria meningitidis 053442
Virulence or Resistance: Virulence
Product : HmbR
Function : -
Note : hemoglobin receptor; similar to NMB1668 from Neisseria meningitidis strain MC58
Homologs in the searched genomes :   No hits  
Publication :
    -Kahler,C.M. and Stephens,D.S., "Direct Submission", Submitted (07-NOV-2000) Microbiology, Monash University, Wellington Rd., Clayton, Vic 3800, Australia.

    -Kahler,C.M., Blum,E., Miller,Y.K., Ryan,D., Popovic,T. and Stephens,D.S., "exl, an exchangeable genetic island in Neisseria meningitidis", Infect. Immun. 69 (3), 1687-1696 (2001) PUBMED 11179344.


DNA sequence :
ATGAAACCATTACAAATGCTCCCTATTGCCGCGCTGGTCGGCAGTATTTT

Protein sequence :
MKPLQMLPIAALVGSI