PAI Gene Information


Name : unnamed
Accession : AAN85142.1
PAI name : Hrp PAI
PAI accession : AY147018
Strain : Pseudomonas syringae 1448A
Virulence or Resistance: Not determined
Product : QueA
Function : -
Note : -
Homologs in the searched genomes :   No hits  
Publication :
    -Charity,J.C., Pak,K., Delwiche,C.F. and Hutcheson,S.W., "Novel exchangeable effector loci associated with the Pseudomonas syringae hrp pathogenicity island: evidence for integron-like assembly from transposed gene cassettes", Mol. Plant Microbe Interact. 16 (6), 495-507 (2003) PUBMED 12795376.

    -Charity,J.C., Pak,K., Delwiche,C.F. and Hutcheson,S.W., "Direct Submission", Submitted (03-SEP-2002) Cell Biology and Molecular Genetics, University of Maryland, College Park, Microbiology Building, College Park, MD 20742, USA.


DNA sequence :
ATGCGCGTCGCTGACTTTACCTTCGAACTCCCCGATTCCCTGATTGCTCGTCACCCGTTGGCCGAGC

Protein sequence :
MRVADFTFELPDSLIARHPLAE