REI Gene Information


Name : unnamed
Accession : AET25402.1
REI name : PAGI-2(C)
REI accession : JF826500
Strain : Pseudomonas aeruginosa B136-33
Resistance or Virulence: Not determined
Product : PA0957-like protein
Function : -
Note : similar to PAO1 PA0957 in INSD accession AE004091
Homologs in the searched genomes :   No hits  
Publication :
    -Martinez,E., Marquez,C., Ingold,A., Merlino,J., Djordjevic,S.P., Stokes,H.W. and Roy Chowdhury,P., "Diverse Mobilized Class 1 Integrons Are Common in the Chromosomes of Pathogenic Pseudomonas aeruginosa Clinical Isolates", Antimicrob. Agents Chemother. 56 (4), 2169-2172 (2012) PUBMED 22271862.

    -Martinez,E., Roy Chowdhury,P. and Stokes,H.W., "Direct Submission", Submitted (20-APR-2011) I3 Institute, University of Technology, Sydney, Harris and Thomas St., Sydney, NSW 2007, Australia.


DNA sequence :
CGCAGAGTAATGAGGAAGACCTGGTGGCCCATGTGACCGGTACCTACGCCCTTCCTTTATAG

Protein sequence :
QSNEEDLVAHVTGTYALPL